Journal: International journal of molecular sciences

Article Title: GSK3α Regulates Temporally Dynamic Changes in Ribosomal Proteins upon Amino Acid Starvation in Cancer Cells.

doi: 10.3390/ijms241713260

Figure Lengend Snippet: Figure 5. Inhibition of specific ribosomal proteins promotes cellular fitness upon GSK3α inhibition and asparagine starvation. (A) Schematic workflow of the CRISPR/Cas9 screen. (B) Top 15 genes that are differentially affected in amino-acid-deprived conditions between the two indicated cell lines from the experiment shown in (A). Ribosomal proteins are highlighted in blue. (C) GSK3α-KO single-cell clones were transduced with indicated sgRNAs and treated with vehicle or 100 U/L of asparaginase in biological duplicates. Relative viability was assessed after 6 days of treatment by counting viable cells. All cell counts were normalized to vehicle-treated cells. Note that asparaginase sensitization was not as striking because clones were chosen based on an intermediate response for the genome-wide CRISPR/Cas9 screen. Statistical significance was assessed using a one-way ANOVA with Dunnett’s adjustment for multiple comparisons. (D,E) Cells were transduced with indicated shRNAs and treated with vehicle or 100 U/L of asparaginase in biological duplicates. Relative viability was assessed after 6 days of treatment by counting viable cells. All cell counts were normalized to vehicle-treated cells. Note that asparaginase sensitization was not as striking because clones were chosen based on an intermediate response for the genome-wide CRISPR/Cas9 screen. Statistical significance was assessed using a one-way ANOVA with Dunnett’s adjustment for multiple comparisons. **** p ≤0.0001, *** p ≤0.001, ** p ≤0.01, * p < 0.05, and n.s. p ≥0.05.

Article Snippet: The genome-wide CRISPR/Cas9 screen was performed by utilizing the human Brunello CRISPR knockout pooled library (a gift from David Root and John Doench; Addgene #73178).

Techniques: Inhibition, CRISPR, Clone Assay, Transduction, Genome Wide

Journal: bioRxiv

Article Title: Sub-Millivolt Voltage Imaging Reveals Gap Junction-Mediated Bioelectric Contact Inhibition

doi: 10.64898/2026.02.10.701308

Figure Lengend Snippet: a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with CRISPR-Cas9. Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.

Article Snippet: The following guide RNAs (gRNAs) from the human CRISPR knockout pooled library A (GeCKOv2) were cloned into the lentiCRISPRv2 (Addgene #52961): GJA1 (Cx43): 19135: TCAGCGCACCACTGGTCGCA, 19136: TGTGTTCTATGTGATGCGAA GJC1 (Cx45): 19177: CATCTTCCCGAATCCGTCGT, 19179: GCAAGCCCTATGCAATGCGC HEK293T cells were transiently transfected with the lentiCRISPRv2 expression plasmids using Roti®-fect.

Techniques: Western Blot, Knock-Out, Generated, CRISPR, Control, Fluorescence, Stable Transfection, Expressing, Over Expression

Journal: STAR Protocols

Article Title: Protocol for genome-scale in vivo CRISPR screening to study protection of beta cells under autoimmunity in a type 1 diabetes mouse model

doi: 10.1016/j.xpro.2023.102155

Figure Lengend Snippet:

Article Snippet: Mouse GeCKO-v2 (Genome-Scale CRISPR Knock-Out) Library A , Addgene , Cat# 1000000052.

Techniques: Virus, Recombinant, Red Blood Cell Lysis, Plasmid Preparation, CRISPR, Knock-Out, Software, Spectrophotometry, In Vivo Imaging, Transferring, Bioassay

Journal: PLoS Genetics

Article Title: Identification of the transcription factor Miz1 as an essential regulator of diphthamide biosynthesis using a CRISPR-mediated genome-wide screen

doi: 10.1371/journal.pgen.1009068

Figure Lengend Snippet: A . A workflow of the whole genome CRISPR knockout screen. 6 × 10 7 HT1080 (Cas9 expressing) cells were infected with the human lentiviral CRISPR library A or B (M.O.I. = 0.3). The CRISPR gene-edited cells were selected by puromycin (5 μg/ml) for 10 days. Then, the cells were treated with PA/FP59 (100 ng/ml each, about 10-fold of the minimum lethal concentration) twice with a two-day interval between treatments, and the toxin-resistant cells were allowed to form colonies by further culturing. The surviving, toxin-resistant cells were pooled, DNA extracted, and the sgRNA-containing fragments amplified and analyzed by Illumina deep sequencing for sgRNAs. B . Top hits from both library-A and library-B by Illumina deep sequencing. Only the genes with Log2(fold change) (LFC) ≥ 3 and were hit by ≥ 2 sgRNAs were considered as true positives and listed, along with the top four potential hits with just a single sgRNAs. Please refer to the and for details.

Article Snippet: The genome-wide CRISPR knockout lentiviral pooled human library-A and library-B developed by Feng Zhang’s MIT laboratory [ ] were used for our unbiased screens for host genes required for the toxin activity (Addgene Cat. # 1000000049).

Techniques: CRISPR, Knock-Out, Expressing, Infection, Concentration Assay, Amplification, Sequencing

Journal: PLoS Genetics

Article Title: Identification of the transcription factor Miz1 as an essential regulator of diphthamide biosynthesis using a CRISPR-mediated genome-wide screen

doi: 10.1371/journal.pgen.1009068

Figure Lengend Snippet: A - C . Knockout of Miz1 in HT1080 (A), RAW264.7 (B), and B16F10 (C) cells by CRISPR gene editing rendered these cells resistant to PA/FP59. The results from several independent clones are shown. In (A), knockout of Dph1 was used as an additional control. The indicated cells were incubated with various concentrations of PA in the presence of FP59 (100 ng/ml) for 48 h, followed by an MTT assay evaluating cell viability. Right panel in (C), lacking of Miz1 expression in representatives of B16 Miz1-KO clones was confirmed by Western blotting using an anti-Miz1 antibody (R&D Systems Cat. No. AF3760). Data are represented as mean (triplicate) ± SD. Unpaired two-tailed Student's t -tests, *, p < 0.001 between wild-type HT1080 (in A), RAW264.7 (in B), or B16F10 (in C) cells and their isogenic Miz1-KO or Dph1-KO cells. D and E . Reversion of the toxin-resistant phenotype of the B16 Miz1-KO cells (D) and HT1080 Miz1-KO cells (E) by transfection of a Miz1-expression plasmid. The results from several independent clones are shown. Cells were incubated with various concentrations of PA in the presence of FP59 (100 ng/ml) for 48 h, followed by an MTT assay evaluating cell viability. Of note, the Miz1-KO cells transfected with Miz1 regained their sensitivity to the toxin. Data are represented as mean (triplicate) ± SD. Unpaired two-tailed Student's t -tests, *, p < 0.001 between B16F10 Miz1-KO (in D) or HT1080 Miz1-KO (in E), and their isogenic Miz1 transfected cells.

Article Snippet: The genome-wide CRISPR knockout lentiviral pooled human library-A and library-B developed by Feng Zhang’s MIT laboratory [ ] were used for our unbiased screens for host genes required for the toxin activity (Addgene Cat. # 1000000049).

Techniques: Knock-Out, CRISPR, Clone Assay, Control, Incubation, MTT Assay, Expressing, Western Blot, Two Tailed Test, Transfection, Plasmid Preparation

Journal: Immunity

Article Title: Chronic calcium signaling in IgE + B cells limits plasma cell differentiation and survival.

doi: 10.1016/j.immuni.2021.11.006

Figure Lengend Snippet: Figure 5. IgE+ B cells and PCs undergo increased apoptosis mediated by BCL2L11 (A) Normalized IgE+ and IgG1+ cell numbers following Bcl2l11-targeting shown as proportions of mCherry+ cells at day 8 of the culture relative to mCherry+ cells at day 3. Data pooled from effects of 2 sgRNAs per gene, in two independent experiments. (B and C) Targeting of Bcl2l11 in iGC cultures using 2 sgRNAs not present in Cherry-Brie library. sgRNA 1 and 2 (g1 and g2) shown as open and closed circles, each point represents a replicate. Proportions of IgE+ PCs (B) and IgG1+ PCs (C) shown for nontargeted (NT) (GFP+ mCherry) and targeted (sgRNA) (GFP+

Article Snippet: The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form theMouse Brie CRISPR knockout pooled library (a gift fromDavid Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Figure S1A).

Techniques:

Journal: Immunity

Article Title: Chronic calcium signaling in IgE + B cells limits plasma cell differentiation and survival.

doi: 10.1016/j.immuni.2021.11.006

Figure Lengend Snippet: Figure 7. Elevated cytosolic calcium in IgE+ B cells drives cell death through BCL2L11 (A) Normalized Indo-1 fluorescence ratio in nontargeted (black dots) and Atp2b1-targeted cells at day 8 of culture. (B) Targeting of Atp2b1 in iGC cultures using 2 sgRNAs not present in Cherry-Brie library. sgRNA 1 and 2 (g1 and g2) shown as open and closed circles, each point represents a replicate. Conditions where 500 ng/ml anti-Igk F(ab0)2 was added for the final 2 days of culture shown in blue. Proportions of IgE+ iGCs, IgE+ PCs, IgG1+ iGCs, and IgG1+ PCs (graphs from left to right) shown for nontargeted (NT) (GFP+ mCherry) and targeted (sgRNA) (GFP+ mCherry+) comparing cells within the same well (connected by a line). Data are pooled from four separate experiments. (C) Proportions of nontargeted (NT) (black dots) and Atp2b1-targeted (red dots) cells that are active caspase-3+ at day 8 of iGC culture. (D) Proportions of IgE+ and IgG1+ cells shown for 10 nM thapsigargin treated (white bars) compared with vehicle treated (black bars) cells, where thapsigargin was added for the final 2 days of iGC cultures. n = 3 biological replicates pooled from two independent experiments. (E) Proportions of annexin V+ cells from iGC cultures as described for (D). n = 4 biological replicates pooled from three independent experiments. (F) Representative flow plot showing Bcl2l11-targeted (BFP+ mCherry), Atp2b1-targeted (BFP mCherry+), nontargeted (NT) (BFP mCherry), and double- targeted (BFP+ mCherry+) populations from the same culture well. (G) Proportion of IgE+ PCs in populations described in (F) comparing cells within the same well (connected by a line). (H) Proportion of active caspase-3+ IgE+ PCs in populations described in (F) comparing cells within the same well (connected by a line). In (G and H), n = 8 technical replicates pooled from two separate experiments. p values indicated using paired t test (B), two-way RM ANOVA with Sidak’s multiple comparisons test (A and C), unpaired t test (D and E), one-way RM ANOVA with Tukey’s multiple comparisons test (G and H). In (A and C) each dot represents a biological replicate, line represents mean. Bars indicate mean ± SEM.

Article Snippet: The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form theMouse Brie CRISPR knockout pooled library (a gift fromDavid Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Figure S1A).

Techniques:

Journal: PLoS Pathogens

Article Title: Heparan sulfate proteoglycans serve as alternative receptors for low affinity LCMV variants

doi: 10.1371/journal.ppat.1009996

Figure Lengend Snippet: (A) Schematic overview of the genome of replication competent VSV-based reporter systems pseudotyped with high or low affinity LCMV GP variants and eGFP as a transgene. (B) Schematic overview of CRISPR Cas9-mediated knockout screen in 293T Δ DAG1 cells with replication competent or incompetent high and low affinity VSV-GP variants. Created with BioRender.com . (C) Enrichment of sgRNA expression after low affinity VSV-ΔG-GP (HPI WT) selection compared to an untreated control (left). Representation of top hits and number of significantly enriched sgRNAs (out of 6) per gene (right; n = 45) and (D) their roles in the heparan sulfate biosynthesis pathway. Enriched genes from the genome-wide CRISPR Cas9 screen are marked in green.

Article Snippet: Three rounds of independent selection experiments of pooled genome-wide CRISPR Cas9 knockout screens were performed using the human GeCKOv2 CRISPR knockout pooled library (a gift from Feng Zhang; # 1000000049; Addgene) [ ].

Techniques: CRISPR, Knock-Out, Expressing, Selection, Control, Genome Wide

Journal: PLoS Pathogens

Article Title: Heparan sulfate proteoglycans serve as alternative receptors for low affinity LCMV variants

doi: 10.1371/journal.ppat.1009996

Figure Lengend Snippet: (A) Flow cytometry analysis of Dystroglycan-1 (IIH6; red) and Heparan sulfate (10E4; blue) expression in 293T WT, Δ DAG1 , Δ EXTL3 , and Δ DAG1 EXTL3 cells generated by CRISPR Cas9-mediated knockout. (B) Infection assay using a lentiviral (LV) reporter system encoding eGFP. LVs were pseudotyped with VSV-G, as a control, and low (HPI WT Y155H or Arm 53b L260F) or high (HPI high H155Y or Arm Cl13 260L) affinity LCMV GP variants. Cells were transduced with an MOI of 1 (determined for 293T WT) and eGFP signal was measured 72 h later by flow cytometry. (C) Infection assay with low (WE HPI or Arm 53b) and high (Arm Cl13) affinity variants of LCMV in different knockout variants of 293T cells. The cells were infected with an MOI of 1 (determined by semi-functional quantitative flow cytometry assay for 293T WT cells) for 2 h at 37°C and 16 h p.i. quantified by flow cytometry via LCMV N-staining. Shown are the means ± SD of three replicates.

Article Snippet: Three rounds of independent selection experiments of pooled genome-wide CRISPR Cas9 knockout screens were performed using the human GeCKOv2 CRISPR knockout pooled library (a gift from Feng Zhang; # 1000000049; Addgene) [ ].

Techniques: Flow Cytometry, Expressing, Generated, CRISPR, Knock-Out, Infection, Control, Transduction, Functional Assay, Staining

Journal: bioRxiv

Article Title: Genome-wide CRISPR/Cas9 screen identifies MAT2A as a critical host factor for BK Polyomavirus

doi: 10.1101/2023.10.20.563362

Figure Lengend Snippet: (A) Creation of Cas9-RPTE/TERT1 cell line : RPTE/TERT1 cells, a human renal cell line was lentivirus transduced to stably express Cas9, shown here by Western blot (i). Cas9 function was validated by further transducing β2M sgRNA, leading to reduction of MHC-I expression on the cell surface, shown here by FACS surface stain for MHC-I (ii). (B) Library Trimming and Quality Control (i-iii) Bar charts showing the distribution of read lengths; The Bassik Human CRISPR knockout library (Addgene), after clipping one nucleotide from the 5’ end of each read (i). The reads from the uninfected cells (ii). The reads from the infected cells, both after trimming terminal Ns and adapters (iii). Bar chart showing the proportion of reads successfully mapped to the library for uninfected (left) and infected (right) cells (iv). Violin plot showing the distribution of normalised read counts per sgRNA calculated with MAGeCK for uninfected (left) and infected (right) cells, excluding sgRNAs with counts of zero (v). Violin plot showing the distribution of normalised read counts summed per gene, calculated with MAGeCK for uninfected (left) and infected (right) cells, excluding genes with counts of zero (vi).

Article Snippet: Cas9-RPTE/Tert1 cells were lentiviral transduced ( ) with a Human CRISPR Knockout library, a gift from Michael Bassik (Addgene #101926 – 101934) at an MOI of ∼0.3 ( ).

Techniques: Stable Transfection, Western Blot, Expressing, Staining, Control, CRISPR, Knock-Out, Infection

Journal: bioRxiv

Article Title: Genome-wide CRISPR/Cas9 screen identifies MAT2A as a critical host factor for BK Polyomavirus

doi: 10.1101/2023.10.20.563362

Figure Lengend Snippet: (A) Experimental design of screen : Cells were transduced with lentivirus comprising sgRNAs of the Bassik CRISPR library, in which there are 10 sgRNAs per gene for all ∼20,500 protein coding genes of the human genome, a puromycin resistance gene and an mCherry gene. Transduced cells were selected in puromycin for 8 days to select for only those cells which were successfully transduced. Puromycin selected cells were then BKPyV infected (MOI 5) or left uninfected to serve as the reference library. After 3 days infected cells were fixed, permeabilised and stained for viral early gene Large T Antigen (LTAg), followed by FACS sorting for mCherry positivity (representing sgRNA transduction and expression), and lowest 10% LTAg expression (reduced early viral gene expression). Next generation sequencing was used to determine the enrichment of specific sgRNA sequences in DNA extracted from the sorted population compared to an unsorted cell population library (B) Plot illustrating the distribution of genes identified from the CRISPR/Cas9 screen: All genes quantified are plotted alphabetically (x-axis) against enrichment significance in the lowest 10% of LTAg expressing cells (y-axis), significance displayed as –Log( p-value ). The top 200 genes (carried forward for DAVID analysis) are either coloured yellow (top 200) or blue (top 200 and involved in RNA or mRNA splicing, a positive control group). Top 10 most significant genes are labelled. One of the most significantly enriched genes was MAT2A, highlighted in this plot in red. Significance of MAT2A p < 0.00005, 9 of 10 MAT2A CRISPR sgRNAs were identified. (C) DAVID analysis of 200 most significantly enriched genes: The 200 most significantly enriched genes present in the sorted population of cells (lowest 10% of BKPyV infected cells expressing the least LTAg) were subjected to DAVID pathway analysis (v6.8), presented here are the results of functional annotation clustering (EASE score <0.05, Min. count 2).

Article Snippet: Cas9-RPTE/Tert1 cells were lentiviral transduced ( ) with a Human CRISPR Knockout library, a gift from Michael Bassik (Addgene #101926 – 101934) at an MOI of ∼0.3 ( ).

Techniques: Transduction, CRISPR, Infection, Staining, Expressing, Gene Expression, Next-Generation Sequencing, Positive Control, Functional Assay

Journal: bioRxiv

Article Title: Genome-wide CRISPR/Cas9 screen identifies MAT2A as a critical host factor for BK Polyomavirus

doi: 10.1101/2023.10.20.563362

Figure Lengend Snippet: (A) Effect of MAT2A functional knockout on viral early gene expression : CRISPR knockout MAT2A single cell clones (RPTE/TERT1 MAT2A K/O) or parent RPTE/TERT1 cells were infected with BKPyV (MOI 3) and formaldehyde fixed at 48 hpi. Cells were stained for LTAg expression and detected by fluorescence microscopy. The number of infected LTAg positive cells were recorded (i), the mean nucleus size of those infected cells was measured (ii) and mean total LTAg fluorescence of infected cells was quantified (iii). All results normalized to parental control cells. Example fluorescence microscopy image shown for reference (iv). (B) Effect of MAT2A functional knockout on viral early and late gene expression : Parent and MAT2A K/O RPTE/TERT1 cells were infected with BKPyV (MOI 3) or mock infected. At 48 hpi cells were harvested and a Western blot conducted. Stained for LTAg, viral late gene VP1, cellular MAT2A/MAT1A and tubulin as a loading control. Densitometry of viral proteins LTAg and VP1 (normalised to tubulin) show significant reduction in viral gene expression in MAT2A K/O cells. (C) Effect of MAT2A functional knockout on viral genome replication : Parent and MAT2A K/O RPTE/TERT1 cells were infected with BKPyV (MOI 3). At 48 hpi cells were pelleted and qPCR conducted. BKPyV genomes per cell were quantified, using GAPDH as a control. Results normalised to parental control cells. (D) Effect of MAT2A functional knockout on viral replication : Parent and MAT2A K/O RPTE/TERT1 cells were infected with BKPyV (MOI 5). At 24, 48 and 72 hpi cells were were harvested and infectious BKPyV was measured by FFU assay. Data from three independent experiments, error bars show standard deviation. * p <0.05, ***, p <0.001; students t-test.

Article Snippet: Cas9-RPTE/Tert1 cells were lentiviral transduced ( ) with a Human CRISPR Knockout library, a gift from Michael Bassik (Addgene #101926 – 101934) at an MOI of ∼0.3 ( ).

Techniques: Functional Assay, Knock-Out, Gene Expression, CRISPR, Clone Assay, Infection, Staining, Expressing, Fluorescence, Microscopy, Control, Western Blot, Standard Deviation